Journal: Journal of Nanobiotechnology

Article Title: A bivalent spike-targeting nanobody with anti-sarbecovirus activity

doi: 10.1186/s12951-025-03243-y

Figure Lengend Snippet: Monovalent and bivalent 7F constructs neutralize authentic SARS-CoV-2 in A549 cells and HAE cell cultures and authentic SARS-CoV in Vero cells. A . Neutralization of SARS-CoV-2 in A549 ACE2+TMPRSS2+ cells. Virus was pre-incubated with serial diluted nanobody, or 10 µM remdesivir, for 30 min before infecting A549 ACE2+TMPRSS2+ cells. Infection was quantified by measuring the virus yield (viral RNA copies/ml, as determined with RT-qPCR) in cell culture supernatants of SARS-CoV-2 infected cells. B . Neutralization of SARS-CoV-2 in HAE cell culture. HAE cultures were incubated with SARS-CoV-2 and 100 nM nanobodies or 10 µM remdesivir on the apical side for 2 h. Nanobody incubation was repeated every 24 h. Graph showing the quantification of viral replication in the cultures, evaluated by RT-qPCR. C . Neutralization of SARS-CoV in Vero cells. Virus was pre-incubated with serial diluted nanobody, or 10 µM remdesivir, for 30 min before infecting Vero cells. Infection was quantified by measuring the virus yield (viral RNA copies/ml, as determined with RT-qPCR) in cell culture supernatants of SARS-CoV infected cells

Article Snippet: A549 cells ( Homo sapiens , lung carcinoma, ATCC CCL-185) expressing human ACE2 receptor protein and TMPRSS2 activating protease (A549 ACE2+TMPRSS2+ ) [ ], Vero cells ( Cercopithecus aethiops , kidney epithelial, ATCC CCL-81) and VeroE6 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS for A549 and Vero cells and 10% FBS for VeroE6 cells, 1 mM sodium pyruvate (Gibco), nonessential amino acids (Lonza), penicillin (100 IU/ml), and streptomycin (100 IU/ml).

Techniques: Construct, Neutralization, Virus, Incubation, Infection, Quantitative RT-PCR, Cell Culture

Journal: Journal of Medical Virology

Article Title: Native and activated antithrombin inhibits TMPRSS2 activity and SARS‐CoV‐2 infection

doi: 10.1002/jmv.28124

Figure Lengend Snippet: Antithrombin inhibits TMPRSS2 protease activity. (A) Docking analysis of AT (orange, from PDB 3KCG) and TMPRSS2 (homology model, UniProtKB O15393, green). The heparin pentasaccharide is shown as spheres and glycoside residues as sticks. The inset shows the AT‐TMPRSS2 catalytic complex after structural refinement. The AT RCL is depicted in orange, TMPRSS2 residues in cyan; water molecules (sticks) within a radius of 5Å and hydrogen bonds (blue lines) are shown. (B) Recombinant TMPRSS2 (residues 106–492) was incubated with two commercially available formulations of AT (Anbinex, Kybernin) or the small molecule TMPRSS2 inhibitor CM, 1h before the addition of fluorogenic TMPRSS2 substrate BOC‐QAR‐AMC. Data are shown as means ± SD derived from n = 2 experiments performed in triplicates. (C) HEK293T cells expressing TMPRSS2 were incubated with AT or CM 1 h before the addition of fluorogenic TMPRSS2 substrate BOC‐QAR‐AMC. Results were corrected for the signal of nontransfected HEK293T cells. Data are shown as means± SEM derived from n = 3 experiments performed in duplicates. AT, antithrombin; CM, camostat mesylate; RCL, reactive center loop; SD, standard deviation; SEM, standard error of the mean.

Article Snippet: Recombinant TMPRSS2 was obtained from CreativeBiomart (TMPRSS2‐1856H) or LSBio (LS‐G57269).

Techniques: Activity Assay, Recombinant, Incubation, Derivative Assay, Expressing, Standard Deviation

Journal: Journal of Medical Virology

Article Title: Native and activated antithrombin inhibits TMPRSS2 activity and SARS‐CoV‐2 infection

doi: 10.1002/jmv.28124

Figure Lengend Snippet: Antithrombin inhibits activity of cathepsin L, while moderately affecting cathepsin B. Recombinant cathepsin L (A) or isolated cathepsin B (B) were incubated with AT (Anbinex), small molecule TMPRSS2 inhibitor CM or small molecule cathepsin inhibitor E64‐d, 1 h before the addition of fluorogenic substrate Z‐L‐R‐AMC (for cathepsin L) or Z‐R‐R‐AMC (for cathepsin B). Data are shown as means ± SEM derived from n = 3 experiments performed in triplicates. AT, antithrombin; CM, camostat mesylate; SEM, standard error of the mean.

Article Snippet: Recombinant TMPRSS2 was obtained from CreativeBiomart (TMPRSS2‐1856H) or LSBio (LS‐G57269).

Techniques: Activity Assay, Recombinant, Isolation, Incubation, Derivative Assay

Journal: Journal of Medical Virology

Article Title: Native and activated antithrombin inhibits TMPRSS2 activity and SARS‐CoV‐2 infection

doi: 10.1002/jmv.28124

Figure Lengend Snippet: Activation of antithrombin increases anti‐TMPRSS2 and anti‐SARS‐CoV‐2 activity. (A) Heparin (Hep)‐ and Fondaparinux (FPX)‐activated antithrombin (Anbinex, 0.0137 µM) was incubated with recombinant TMPRSS2 enzyme before the addition of fluorogenic TMPRSS2 substrate BOC‐QAR‐AMC. Data are shown as means ± SEM derived from n = 3 experiments performed in triplicates. (B) HEK293T cells expressing TMPRSS2 were incubated with Hep‐ or FPX‐activated Anbinex (0.17 µM) before the addition of fluorogenic TMPRSS2 substrate BOC‐QAR‐AMC. Results were corrected for the signal of nontransfected HEK293T cells. Data are shown as means± SEM derived from n = 3 experiments performed in duplicates. (C) Caco2 cells were treated with Hep‐ or FPX‐activated Anbinex (13.75 µM) for 1 h before infection of cells with SARS‐CoV‐2 isolate Wuhan/Hu‐1 (Spike mutation D614G) at an MOI of 0.0002. Data are shown as means ± SD derived from n = 2 experiments performed in triplicates. (D) Caco2 cells were treated with FPX‐activated Anbinex (13.75 µM) for 1 h before infection of cells with the indicated SARS‐CoV‐2 isolates at an MOI of 0.005. Data are shown as means ± SEM derived from n = 3 experiments. Infection rates of (C) and (D) were assessed by flow cytometric analysis of SARS‐CoV‐2 nucleocapsid (N) protein expression in single cells at 2 dpi (C) or 1 dpi (D). Maximum final concentrations of Hep and FPX on cells were 0.4 mg/ml, corresponding to 22.2 or 232 µM, respectively. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, assessed by two‐way analysis of variance with Dunnett's multiple comparisons test. MOI, multiplicity of infection; SD, standard deviation; SEM, standard error of the mean.

Article Snippet: Recombinant TMPRSS2 was obtained from CreativeBiomart (TMPRSS2‐1856H) or LSBio (LS‐G57269).

Techniques: Activation Assay, Activity Assay, Incubation, Recombinant, Derivative Assay, Expressing, Infection, Mutagenesis, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Endothelial Immunity Trained by Coronavirus Infections, DAMP Stimulations and Regulated by Anti-Oxidant NRF2 May Contribute to Inflammations, Myelopoiesis, COVID-19 Cytokine Storms and Thromboembolism

doi: 10.3389/fimmu.2021.653110

Figure Lengend Snippet: (A–E) The mRNA transcripts of four types of coronavirus receptors such as membrane alanyl aminopeptidase (ANPEP, CD13, receptor for human coronavirus-229E), carcinoembryonic antigen family cell adhesion molecule 1 (CEACAM1, receptor for mouse hepatitis virus), angiotensin-converting enzyme 2 (ACE, receptor for SARS-CoV, SARS-CoV2), and dipeptidyl peptidase-4 (DPP4, receptor for MERS-CoV) as well as TMPRSS2 are found in two clusters of human heart endothelial cells. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP498/transcriptional-and-cellular-diversity-of-the-human-heart#study-summary ). (F–J) The mRNA transcripts of four types of coronavirus receptors such as ANPEP, CEACAM1, ACE, and DPP4 are found in mouse aortic endothelial cell clusters. The data mining analyses were performed on the Single Cell RNA-Seq database of the Broad Institute of MIT and Harvard (Single CellBeta Portal; https://singlecell.broadinstitute.org/single_cell/study/SCP289/single-cell-analysis-of-the-normal-mouse-aorta-reveals-functionally-distinct-endothelial-cell-populations#study-summay , PMID: 31146585). (F) ANPEP expressions in three endothelial cell clusters were circled in red in the Scatter; (G) ANPEP expressions in three endothelial cell clusters were boxed in red in the Distribution; (H) CEACAM1 expressions in three endothelial cell clusters were also boxed in read in the Distribution; (I) ACE expressions in three endothelial cell clusters were also boxed in read in the Distribution; (J) DPP4 expressions in three endothelial cell clusters were also boxed in read in the Distribution. (K) A new working model: Infection of vascular endothelial cells by SARS-CoV2/MERS-CoV causes innate immune responses in endothelial cells, which may induces cytokine storm, and triggers thromboembolism. The part of figure was created with BioRender.com .

Article Snippet: To test this hypothesis, we searched the expression of these four receptors and coronavirus S protein priming serine protease TMPRSS2 ( ) in human EC in the MIT-Harvard Broad Institute Single Cell Beta Porter single-cell RNA-Seq database, Study: Transcriptional and Cellular Diversity of the Human Heart ( https://singlecell.broadinstitute.org/single_cell/study/SCP498 ).

Techniques: Membrane, Virus, RNA Sequencing, Single-cell Analysis, Infection

Journal: bioRxiv

Article Title: Interferon-regulated genetic programs and JAK/STAT pathway activate the intronic promoter of the short ACE2 isoform in renal proximal tubules

doi: 10.1101/2021.01.15.426908

Figure Lengend Snippet: (A) ACE2 , TMPRSS2 and STAT1 mRNA levels from control and experimental cells were measured by qRT–PCR and normalized to GAPDH levels. Relative mRNA levels of (D) full length ACE2 ( flACE2 ), (E) dACE2 , after cytokine treatment. (F) flACE2 , (G) dACE2 and (H) STAT1 in cells treated with JAK inhibitor ruxolitinib or vehicle, alone or together with IFNß. Individual data points as well as mean ± SEM of independent biological replicates ( n = 3) are shown. One- or two-way ANOVA followed by Tukey’s multiple comparisons test was used to evaluate the statistical significance of differences relative to untreated cells. * P < 0.05, **** P < 0.0001

Article Snippet: After cytokine stimulation, cells were washed twice with PBS before RNA isolation to remove medium and debris. mRNA was isolated using PureLink ® RNA Mini Kit (Invitrogen) and 500 ng was transcribed into cDNA using SuperScript ® III First-Strand Synthesis SuperMix (Invitrogen). qRT-PCR reaction was prepared with SsoAdvanced Universal Probes Supermix (Bio-Rad) and following Taqman probes (ThermoFisher): GAPDH (Hs02786624_g1), ACE2 (Hs01085333_m1), TMPRSS2 (Hs01122322_m1) and STAT1 (Hs01013996_m1) (Bio-Rad) or following primers: dACE2 forward: 5’ GGAAGCAGGCTGGGACAAA 3’, dACE2 reverse: 5’ AGCTGTCAGGAAGTCGTCCATT 3’, ACE2 forward: 5’ GGGCGACTTCAGGATCCTTAT 3’, ACE2 reverse: 5’ GGATATGCCCCATCTCATGATG 3’.

Techniques: Control, Quantitative RT-PCR

Journal: bioRxiv

Article Title: Bromelain Inhibits SARS-CoV-2 Infection in VeroE6 Cells

doi: 10.1101/2020.09.16.297366

Figure Lengend Snippet: A and B Immunoprobing of ACE-2 and TMPRSS2 in various normal and cancerous cells. C. Immunodetection of ACE-2 and TMPRSS2 in bromelain (19, 37, 75 μg/ml for 48 h) treated VeroE6 cells. D. Immunodetection of ACE-2 and TMPRSS2 in bromelain (75 μg/ml for 1–4 h) treated VeroE6 cells. E . Recombinant TMPRSS2 was treated with bromelain (1:1 ratio) for 30, 60, 120 and 240 min at 37°C. F . Immunoprobing of ACE-2 and TMRSS2 in bromelain (75 μg/ml) plus E-64 (4 μM) treated VeroE6 cells. Detection of β-actin served as a loading control.

Article Snippet: Next, we confirmed the bromelain’s activity by treating recombinant TMPRSS2 (Abnova, CA, USA) that showed a complete loss of TMPRSS2 ( ).

Techniques: Immunodetection, Recombinant, Control

Journal: Frontiers in Immunology

Article Title: Blockade of TMPRSS2-mediated priming of SARS-CoV-2 by lactoferricin

doi: 10.3389/fimmu.2022.958581

Figure Lengend Snippet: Effect of LF and the LF-derived peptides pLF1-pLF3 on the activity of serine proteases. Proteolytic activities of purified TMPRSS2 (A) , plasmin (B) , elastase (C) , and trypsin (D) were measured with or without peptides pLF1, pLF2, pLF3, LF or the control peptide pCTR at 37°C in Tris-HCl buffer using the fluorogenic substrate Boc-Gln-Ala-Arg-AMC. The reaction was monitored using an ELISA reader for the indicated time intervals. The insets in (A) and (B) show concentration-dependent inhibition of TMPRSS2 and plasmin activities by pLF1 but not by LF after 30 min and 4 h, Values of p*<0.05, p**<0.005, p***<0.0005, p****<0.0001 (as indicated) were considered to be significant or highly significant, respectively.

Article Snippet: The proteolytic activities of plasmin (10 nM; from human plasma; #10602361001, Roche Diagnostics GmbH, Mannheim, Germany), trypsin (10 nM; from bovine pancreas; #T1005, Sigma-Aldrich, St. Louis, MO), elastase (20 nM; from porcine pancreas; #E1250, Sigma-Aldrich) and TMPRSS2 (25 nM; recombinant protein produced in mammalian cells; #MBS1193731, MyBioSource, San Diego, CA) were measured in a Nunc black fluorescence-based cell assay plate (Sigma-Aldrich) in Tris-HCl buffer (20 mM, pH 8.0, 150 mM NaCl).

Techniques: Derivative Assay, Activity Assay, Purification, Control, Enzyme-linked Immunosorbent Assay, Concentration Assay, Inhibition

Journal: Frontiers in Immunology

Article Title: Blockade of TMPRSS2-mediated priming of SARS-CoV-2 by lactoferricin

doi: 10.3389/fimmu.2022.958581

Figure Lengend Snippet: Effect of LF and the LF-derived peptides on SARS-CoV-2 S protein proteolytic processing. (A) The purified recombinant 6x-His-tagged S protein was exposed to TMPRSS2 with or without pLF1 or pCTR at 37°C in Tris-HCl buffer for 2 h. The digestion of the S protein was analyzed by immunoblotting of the reaction mixtures followed by an incubation with the specific anti-6x-His mAb. Upon cleavage by TMPRSS2, a digestion product of the S protein of about 75 kD became visible (marked by *). (B) Densitometric quantifications of the proteolytic processing of the S protein by TMPRSS2. Peptide pCTR served as a control. Four independent immunoblotting experiments were evaluated. The bands corresponding to the full-length S protein in the absence of TMPRSS2 were set as a relative maximum of 100%. The immunoblots were quantified by the AzureSpot software. (C) Purified recombinant 6x-His-tagged S protein was exposed to plasmin instead of TMPRSS2 and treated afterwards as in (A) . (D) Densitometric quantifications of the proteolytic processing of the S protein by plasmin. Peptide pCTR served as a control. Densitometric evaluation of three independent immunoblotting experiments was performed as in (B) . (E-G) The purified recombinant 8x-His-tagged mutated S protein was treated in in vitro proteolysis assay with TMPRSS2 (E) and plasmin (F) as in (A, C) , and the cleavage (G) was evaluated as in (B, D) Values of p*<0.05, p**<0.005 (as indicated) were considered to be significant..

Article Snippet: The proteolytic activities of plasmin (10 nM; from human plasma; #10602361001, Roche Diagnostics GmbH, Mannheim, Germany), trypsin (10 nM; from bovine pancreas; #T1005, Sigma-Aldrich, St. Louis, MO), elastase (20 nM; from porcine pancreas; #E1250, Sigma-Aldrich) and TMPRSS2 (25 nM; recombinant protein produced in mammalian cells; #MBS1193731, MyBioSource, San Diego, CA) were measured in a Nunc black fluorescence-based cell assay plate (Sigma-Aldrich) in Tris-HCl buffer (20 mM, pH 8.0, 150 mM NaCl).

Techniques: Derivative Assay, Purification, Recombinant, Western Blot, Incubation, Control, Software, In Vitro, Proteolysis Assay

Journal: Frontiers in Immunology

Article Title: Blockade of TMPRSS2-mediated priming of SARS-CoV-2 by lactoferricin

doi: 10.3389/fimmu.2022.958581

Figure Lengend Snippet: Generation and testing of human LFC. (A) Optimizations of HCl and pepsin concentrations (mM and % (w/w), respectively) on LF cleavage. LF (10.5 mg/mL) was exposed to pepsin (3% or 10% per amount of LF) and HCl (10-90 mM, as indicated) for 30 min (left panel) or various time points (15, 30, 45 or 60 min, right panel) at 37°C. Digestion mixtures were analyzed by 10% tricine-SDS-PAGE and subjected to Coomassie blue staining. (B) Separation of LF cleavage products by cation exchange chromatography. Individual fractions were analyzed by 10% tricine-SDS-PAGE and subjected to Coomassie blue staining: L – digestion mixture, X1 - material not captured on the column, A2, A4, A5, A6 - eluted fractions. (C) Effect of LFC (fraction A6) on the activity of TMPRSS2. Proteolytic activity of TMPRSS2 was measured with or without LFC or pCTR at 37°C in Tris-HCl buffer using the fluorogenic substrate Boc-Gln-Ala-Arg-AMC. The reaction was monitored using an ELISA reader for the indicated time intervals. (D) Effect of LFC on the infection capability of SARS-CoV-2. Vero cells were incubated with or without LFC or pCTR (both 80 µg/mL) for approx. 1 h, and then infected with the authentic SARS-CoV-2 (300 TCID50/well; MOI ≈0.02). After 48 h, the cells were fixed and the infection rate was assessed by In-Cell ELISA. Values show mean inhibitory capacity of LFC and pCTR ± SD from three independent experiments. p*<0.05.

Article Snippet: The proteolytic activities of plasmin (10 nM; from human plasma; #10602361001, Roche Diagnostics GmbH, Mannheim, Germany), trypsin (10 nM; from bovine pancreas; #T1005, Sigma-Aldrich, St. Louis, MO), elastase (20 nM; from porcine pancreas; #E1250, Sigma-Aldrich) and TMPRSS2 (25 nM; recombinant protein produced in mammalian cells; #MBS1193731, MyBioSource, San Diego, CA) were measured in a Nunc black fluorescence-based cell assay plate (Sigma-Aldrich) in Tris-HCl buffer (20 mM, pH 8.0, 150 mM NaCl).

Techniques: SDS Page, Staining, Chromatography, Activity Assay, Enzyme-linked Immunosorbent Assay, Infection, Incubation, In-Cell ELISA

Journal: International Journal of Molecular Sciences

Article Title: Molecular Interactions of Tannic Acid with Proteins Associated with SARS-CoV-2 Infectivity

doi: 10.3390/ijms23052643

Figure Lengend Snippet: Inhibitory effects of TA, TGG, and corilagin on human transmembrane protease serine 2 (TMPRSS2) activity. The effects of different concentrations (0.1 to 100 µM) of ( A ) TA, ( B ) TGG, and ( C ) corilagin are tested on the activity of TMPRSS2. The fluorescence units in control conditions are considered as 100%. Blank values are subtracted from all the readings before the conversion into percentage of activity. Results are expressed as mean ± SD (n = 3). Statistical analysis is performed using one-way ANOVA followed by Tukey post hoc test with *** p < 0.001 compared to positive control wells.

Article Snippet: Recombinant human TMPRSS2 protein (106–492 aa), with a MW of 44.8 kDa, was purchased from Creative Biomart.

Techniques: Activity Assay, Fluorescence, Control, Positive Control

Journal: International Journal of Molecular Sciences

Article Title: Molecular Interactions of Tannic Acid with Proteins Associated with SARS-CoV-2 Infectivity

doi: 10.3390/ijms23052643

Figure Lengend Snippet: Biophysical characterization of the molecular interactions between TA and TMPRSS2. ( A ) The recombinant protein TMPRSS2 is immobilized on a CM5 sensor chip, and increasing concentrations of TA are injected to evaluate binding kinetics by SPR. ( B ) TMPRSS2 is adsorbed to a gold QCMD sensor, and various concentrations of TA are flowed over the surface for 30 min. TA adsorption is expressed by the dimensionless molar ratio of adsorbed TA to adsorbed TMPRSS2.

Article Snippet: Recombinant human TMPRSS2 protein (106–492 aa), with a MW of 44.8 kDa, was purchased from Creative Biomart.

Techniques: Recombinant, Injection, Binding Assay, Adsorption

Journal: International Journal of Molecular Sciences

Article Title: Molecular Interactions of Tannic Acid with Proteins Associated with SARS-CoV-2 Infectivity

doi: 10.3390/ijms23052643

Figure Lengend Snippet: Binding free energy between proteins (RBD, TMPRSS2, 3CLpro) and TA for the best poses found during docking. The MD MMPBSA binding free energy is computed over the interval 750 to 1000 ns using the g\_mmpbsa tools [ 49 ].

Article Snippet: Recombinant human TMPRSS2 protein (106–492 aa), with a MW of 44.8 kDa, was purchased from Creative Biomart.

Techniques: Binding Assay

Journal: International Journal of Molecular Sciences

Article Title: Molecular Interactions of Tannic Acid with Proteins Associated with SARS-CoV-2 Infectivity

doi: 10.3390/ijms23052643

Figure Lengend Snippet: Molecular structures (pose 1) of: ( A ) TA/RBD, ( B ) TA/TMPRSS2, and ( C ) TA/3CLpro complexes, before (green) and after (turquoise) 1000-ns MD simulations.

Article Snippet: Recombinant human TMPRSS2 protein (106–492 aa), with a MW of 44.8 kDa, was purchased from Creative Biomart.

Techniques:

Journal: International Journal of Molecular Sciences

Article Title: Molecular Interactions of Tannic Acid with Proteins Associated with SARS-CoV-2 Infectivity

doi: 10.3390/ijms23052643

Figure Lengend Snippet: Molecular structures after 1000 ns of MD: ( A ) TA/TMPRSS2 complex (pose 1; MMPBSA binding free energy of −68 kcal/mol) and ( B ) ligand interaction map. The interaction map of TA with TMPRSS2 is shown from the center of the biggest cluster computed on the convergence interval using the protein backbone atoms and ligand non-hydrogen atoms. The other contacts, defined by a distance smaller than 0.40 nm between the ligand and the protein, are shown as red arcs. H-bonds and their donor/acceptor distances are shown in green. The interaction map is generated using LigPlot [ , ].

Article Snippet: Recombinant human TMPRSS2 protein (106–492 aa), with a MW of 44.8 kDa, was purchased from Creative Biomart.

Techniques: Binding Assay, Generated